imagej graphpad prism 7 Search Results


algorithms imaris software bitplane  (Oxford Instruments)
99
Oxford Instruments algorithms imaris software bitplane
Algorithms Imaris Software Bitplane, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/algorithms imaris software bitplane/product/Oxford Instruments
Average 99 stars, based on 1 article reviews
algorithms imaris software bitplane - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier
algorithms fiji imagej  (LI-COR)
99
LI-COR algorithms fiji imagej
Algorithms Fiji Imagej, supplied by LI-COR, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/algorithms fiji imagej/product/LI-COR
Average 99 stars, based on 1 article reviews
algorithms fiji imagej - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier
graphpad prism 7.0  (GraphPad Software Inc)
90
GraphPad Software Inc graphpad prism 7.0
Graphpad Prism 7.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/graphpad prism 7.0/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
graphpad prism 7.0 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
prism 7  (GraphPad Software Inc)
90
GraphPad Software Inc prism 7
Prism 7, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prism 7/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prism 7 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
graphpad prism 7.03  (GraphPad Software Inc)
90
GraphPad Software Inc graphpad prism 7.03
Graphpad Prism 7.03, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/graphpad prism 7.03/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
graphpad prism 7.03 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
algorithms nis elements software nikon n a imagej nih  (Nikon)
99
Nikon algorithms nis elements software nikon n a imagej nih
Figure 7. LBDXL Hepatocytes Could Repopu- late Fah/ Mouse Livers (A) Kaplan-Meier curve showed the survival rate of cell-transplanted Fah/ mice after removing the supply of NTBC. (B and C) After immunohistochemical staining of Fah, liver repopulation by LBDXL hepatocytes and FH was quantified using <t>ImageJ</t> software (B). Immunohistochemical staining of Fah was shown in (C). Data are expressed as means ± SEMs. (D) The transplanted cells demonstrated mature hepatocyte phenotypes with the expression of Fah, Alb, and the bile canaliculus marker Dpp4. The scale bar represents 200 mM. See also Figure S7.
Algorithms Nis Elements Software Nikon N A Imagej Nih, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/algorithms nis elements software nikon n a imagej nih/product/Nikon
Average 99 stars, based on 1 article reviews
algorithms nis elements software nikon n a imagej nih - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier
imagej graphpad prism 7  (GraphPad Software Inc)
90
GraphPad Software Inc imagej graphpad prism 7
Figure 7. LBDXL Hepatocytes Could Repopu- late Fah/ Mouse Livers (A) Kaplan-Meier curve showed the survival rate of cell-transplanted Fah/ mice after removing the supply of NTBC. (B and C) After immunohistochemical staining of Fah, liver repopulation by LBDXL hepatocytes and FH was quantified using <t>ImageJ</t> software (B). Immunohistochemical staining of Fah was shown in (C). Data are expressed as means ± SEMs. (D) The transplanted cells demonstrated mature hepatocyte phenotypes with the expression of Fah, Alb, and the bile canaliculus marker Dpp4. The scale bar represents 200 mM. See also Figure S7.
Imagej Graphpad Prism 7, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/imagej graphpad prism 7/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
imagej graphpad prism 7 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
imagej plugin s-6  (GraphPad Software Inc)
90
GraphPad Software Inc imagej plugin s-6
Figure 7. LBDXL Hepatocytes Could Repopu- late Fah/ Mouse Livers (A) Kaplan-Meier curve showed the survival rate of cell-transplanted Fah/ mice after removing the supply of NTBC. (B and C) After immunohistochemical staining of Fah, liver repopulation by LBDXL hepatocytes and FH was quantified using <t>ImageJ</t> software (B). Immunohistochemical staining of Fah was shown in (C). Data are expressed as means ± SEMs. (D) The transplanted cells demonstrated mature hepatocyte phenotypes with the expression of Fah, Alb, and the bile canaliculus marker Dpp4. The scale bar represents 200 mM. See also Figure S7.
Imagej Plugin S 6, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/imagej plugin s-6/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
imagej plugin s-6 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
prism 7.00  (GraphPad Software Inc)
90
GraphPad Software Inc prism 7.00
Figure 7. LBDXL Hepatocytes Could Repopu- late Fah/ Mouse Livers (A) Kaplan-Meier curve showed the survival rate of cell-transplanted Fah/ mice after removing the supply of NTBC. (B and C) After immunohistochemical staining of Fah, liver repopulation by LBDXL hepatocytes and FH was quantified using <t>ImageJ</t> software (B). Immunohistochemical staining of Fah was shown in (C). Data are expressed as means ± SEMs. (D) The transplanted cells demonstrated mature hepatocyte phenotypes with the expression of Fah, Alb, and the bile canaliculus marker Dpp4. The scale bar represents 200 mM. See also Figure S7.
Prism 7.00, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prism 7.00/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prism 7.00 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
prism7  (GraphPad Software Inc)
90
GraphPad Software Inc prism7
KEY RESOURCES TABLE
Prism7, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prism7/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
prism7 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
algorithms image lab bio rad n a graphpad prism 7 0 graphpad software n a spss v24 ibm n a flowjo tree star  (Bio-Rad)
99
Bio-Rad algorithms image lab bio rad n a graphpad prism 7 0 graphpad software n a spss v24 ibm n a flowjo tree star
KEY RESOURCES TABLE
Algorithms Image Lab Bio Rad N A Graphpad Prism 7 0 Graphpad Software N A Spss V24 Ibm N A Flowjo Tree Star, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/algorithms image lab bio rad n a graphpad prism 7 0 graphpad software n a spss v24 ibm n a flowjo tree star/product/Bio-Rad
Average 99 stars, based on 1 article reviews
algorithms image lab bio rad n a graphpad prism 7 0 graphpad software n a spss v24 ibm n a flowjo tree star - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier
software graphpad prism 7.0  (GraphPad Software Inc)
90
GraphPad Software Inc software graphpad prism 7.0
KEY RESOURCES TABLE
Software Graphpad Prism 7.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/software graphpad prism 7.0/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
software graphpad prism 7.0 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


Figure 7. LBDXL Hepatocytes Could Repopu- late Fah/ Mouse Livers (A) Kaplan-Meier curve showed the survival rate of cell-transplanted Fah/ mice after removing the supply of NTBC. (B and C) After immunohistochemical staining of Fah, liver repopulation by LBDXL hepatocytes and FH was quantified using ImageJ software (B). Immunohistochemical staining of Fah was shown in (C). Data are expressed as means ± SEMs. (D) The transplanted cells demonstrated mature hepatocyte phenotypes with the expression of Fah, Alb, and the bile canaliculus marker Dpp4. The scale bar represents 200 mM. See also Figure S7.

Journal: Cell reports

Article Title: Maintenance of Primary Hepatocyte Functions In Vitro by Inhibiting Mechanical Tension-Induced YAP Activation.

doi: 10.1016/j.celrep.2019.10.128

Figure Lengend Snippet: Figure 7. LBDXL Hepatocytes Could Repopu- late Fah/ Mouse Livers (A) Kaplan-Meier curve showed the survival rate of cell-transplanted Fah/ mice after removing the supply of NTBC. (B and C) After immunohistochemical staining of Fah, liver repopulation by LBDXL hepatocytes and FH was quantified using ImageJ software (B). Immunohistochemical staining of Fah was shown in (C). Data are expressed as means ± SEMs. (D) The transplanted cells demonstrated mature hepatocyte phenotypes with the expression of Fah, Alb, and the bile canaliculus marker Dpp4. The scale bar represents 200 mM. See also Figure S7.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Alb, goat polyclonal antibody Abcam Cat# ab19194; RRID:AB_777886 Anti-Hnf4a, rabbit polyclonal antibody Santa Cruz Biotechnology Cat# sc-8987; RRID:AB_2116913 Anti-Yap, mouse monoclonal antibody (Clone 63.7) Santa Cruz Biotechnology Cat# sc-101199; RRID:AB_1131430 Anti-Yap, mouse monoclonal antibody (Clone H-9) Santa Cruz Biotechnology Cat# sc-271134; RRID:AB_10612397 Anti-Fah, rabbit polyclonal antibody Abbomax Cat# 602-910 Anti-b-Catenin, mouse monoclonal antibody (Clone 14/Beta-Catenin) BD Biosciences Cat# 610154; RRID:AB_397555 Anti-E-Cadherin, rat monoclonal antibody (Clone DECMA-1) Santa Cruz Biotechnology Cat# sc-59778; RRID:AB_781738 Anti-Dpp4, goat polyclonal antibody R&D Systems Cat# AF954; RRID:AB_355739 Anti-Flag, mouse monoclonal antibody (Clone FG4R) Invitrogen Cat# MA1-91878; RRID:AB_1957945 Bacterial and Virus Strains AAV2/8-CAG-EGFP-T2A-Cre Obio Technology N/A AAV2/8-CAG-GFP Obio Technology N/A AAV2/8-EF1A-EGFP-P2A-Flag-Yap 5SA Obio Technology N/A AAV2/8-EF1A-EGFP-P2A-MSC-3Flag Obio Technology N/A Chemicals, Peptides, and Recombinant Proteins Chemical library See Table S1 Dexamethasone Sigma Cat# D4902 L-Ascorbic acid 2-phosphate Sigma Cat# A8960 N-2 Supplement (100X) Thermo Fisher Scientific Cat# 17502048 B-27 Supplement (50X), serum free Thermo Fisher Scientific Cat# 17504044 Matrigel, growth factor reduced Corning Cat# 356231 Dispase Thermo Fisher Scientific Catalog# 17105041 Collagenase, Type IV Thermo Fisher Scientific Catalog# 17104019 Critical Commercial Assays RNA sequencing Shanghai OE Biotech N/A Deposited Data Raw and analyzed data This paper GEO: GSE138158 Experimental Models: Organisms/Strains C57BL/6 and 129 mice Shanghai SLAC Laboratory N/A C57BL/6 Yapf/f mice Zhang et al., 2010 N/A Rosa26loxP-mTom-stop-loxP–mGFP (mTmG) mice Jackson Laboratory Cat# 007576 129 FAH / mice Overturf et al., 1997 N/A Oligonucleotides Primers for real-time PCR, see Table S2 This paper N/A Recombinant DNA pCMV-flag Yap2 5SA Zhao et al., 2007 Addgene Plasmid #27371 pAAV-EF1A-EGFP-P2A-MSC-3Flag Obio Technology N/A pAAV-EF1A-EGFP-P2A-Flag-Yap 5SA This study N/A Software and Algorithms NIS-Elements software Nikon N/A ImageJ NIH https://imagej.nih.gov/ij/download.html GraphPad Prism 7.04 GraphPad N/A R R Studio https://rstudio.com/products/rstudio/ Cell Reports 29, 3212–3222.e1–e4, December 3, 2019 e1

Techniques: Immunohistochemical staining, Staining, Software, Expressing, Marker

KEY RESOURCES TABLE

Journal: Cell reports

Article Title: Striatal Projection Neurons Require Huntingtin for Synaptic Connectivity and Survival

doi: 10.1016/j.celrep.2019.12.069

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: MGI: 2177755 Oligonucleotides Htt Forward Primer: CAGGTCCGGCAGAGGAAC This Paper N/A Htt Reverse Primer: CATAGCGATGCCCAAGAGTT This Paper N/A pENK Forward Primer: GTTGTCTCCCGTTCCCAGTA This Paper N/A pENK Reverse Primer: GACAGCAGCAAACAGGATGA This Paper N/A Tac1 Forward Primer: TCGATGCCAACGATGATCTA This Paper N/A Tac1 Reverse Primer: AGCCTTTAACAGGGCCACTT This Paper N/A DARPP-32 Forward Primer: CCCAAAGTCGAAGAGACCCA This Paper N/A DARPP-32 Reverse Primer: CCGAAGCTCCCCTAACTCATC This Paper N/A Software and Algorithms Statistica StatSoft http://www.statsoft.com/Produ cts/STATISTICA-Features Prism7 GraphPad https://www.graphpad.com/scientiflc-software/prism/ Imaris 9.0.0 Oxford Instruments https://imaris.oxinst.com/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Open in a separate window KEY RESOURCES TABLE Loss of Htt in striatal neurons recapitulates key features of Huntington’s disease Striatal neurons require Htt for survival during aging Deletion of Htt from striatal neurons disrupts synaptic connectivity

Techniques: Isolation, Reverse Transcription, Software